rs75453245 chr11:3807993 A>C
- Sequence
gtggctggaaatcctttctgcgct[A/C]cgtaggacagggcgccctctcctg
- ASB in cell types
- epidermal keratinocytes foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 1.73 | n/a | 2.00 | |||
| foreskin keratinocyte | 0.44 | n/a | 2.67 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood