rs754643 chr15:59689586 T>C
- Sequence
aggcgtttcttccctctttgctgt[T/C]cgcagggacgctgcctggtagttt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells) fetal bone marrow-derived mononuclear cells monocyte-derived macrophages
- ASB for transcription factors
- KMT2A_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | 2.56 | n/a | 1.50 | n/a | n/a | |||
| CREB1_HUMAN | -0.21 | 1.28 | 1.46 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Testis, Thyroid, Whole_Blood