rs754799 chr19:1904613 T>G
- Sequence
cactttttcctccttactggtttg[T/G]caagactctggcatcggagcctga
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) CD14+ monocytes MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- STAT1_HUMAN FOXK2_HUMAN GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.92 | -3.47 | 2.50 | n/a | No Hit | |||
| FOXK2_HUMAN | 2.18 | 0.88 | 1.78 | n/a | n/a | |||
| GRHL2_HUMAN | 0.00 | 0.95 | 1.92 | 0.40 | Weak Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP premature ovarian failure, spine bone mineral density (bmd), variant creutzfeldt-jakob disease, years of education
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach