rs754868 chr2:42958392 A>G
- Sequence
tcagaaaactgagaagtgaagagt[A/G]tagggaagtctgcgtggctccggc
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 1.61 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, diastolic blood pressure (dbp), fasting blood glucose, mean arterial pressure, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp)