rs7549012 chr1:147717139 A>G
- Sequence
gaagaacttcctgattgaaatctg[A/G]tcttgtaaggtacctggatgtgct
- ASB in cell types
- HepG2 (hepatoblastoma) breast tumor tissue ZR-75-1 (invasive ductal carcinoma)
- ASB for transcription factors
- NFIL3_HUMAN FOXA1_HUMAN FOXA2_HUMAN ETV5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIL3_HUMAN | 2.56 | n/a | 1.50 | n/a | n/a | |||
| FOXA1_HUMAN | 1.87 | -3.17 | 2.88 | n/a | No Hit | |||
| FOXA2_HUMAN | 1.63 | -1.90 | 1.33 | n/a | No Hit | |||
| ETV5_HUMAN | 2.04 | -1.72 | 1.33 | n/a | No Hit | |||
| SOX13_HUMAN | 1.83 | -1.77 | 1.50 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, ldl cholesterol
GTEx eQTL Adrenal_Gland, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid