rs7551464 chr1:157085606 G>A
- Sequence
taaatgtgatttcttaaaactgtg[G/A]taatcttttggaggatagttgggc
- ASB in cell types
- HL-60 (acute myeloid leukemia) macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HL-60 (acute myeloid leukemia) | 1.69 | -1.72 | 1.33 | |||
| macrophages | 0.97 | n/a | 2.50 |
Items per page:
1 – 2 of 2