rs7556447 chr1:2414660 C>G
- Sequence
ccccaaagggaatcgaatctagat[C/G]agaaccactggcgaagtggagcga
- ASB in cell types
- erythroid cells PC3 (prostate carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | -3.05 | 2.34 | 2.00 | |||
| PC3 (prostate carcinoma) | -0.97 | 1.97 | 3.50 | |||
| GM12878 (female B-cells) | 0.58 | 0.66 | 1.28 |
Items per page:
1 – 3 of 3