rs756137 chr6:33788113 T>C
- Sequence
accagaggttggaggagcagtgac[T/C]acagcttgtgattgaaagggagac
- ASB in cell types
- K562 (myelogenous leukemia) periferal blood macrophages
- ASB for transcription factors
- NRF1_HUMAN E4F1_HUMAN HDAC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 1.66 | -0.82 | 2.33 | n/a | No Hit | |||
| E4F1_HUMAN | 1.83 | -0.79 | 2.17 | n/a | n/a | |||
| HDAC2_HUMAN | 2.16 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), height, rheumatoid arthritis, systolic blood pressure (sbp), triglycerides change with statins, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Caudate_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood