rs7567461 chr2:112049516 G>T
- Sequence
caggcggaccgtggtctagtggta[G/T]cgtaagtgtcaaggaaaaacaccc
- ASB in cell types
- pancreas MCF10A (breast epithelial cells) thyroid gland adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 1.99 | -2.22 | 1.33 | |||
| MCF10A (breast epithelial cells) | 2.06 | -1.79 | 1.33 | |||
| thyroid gland | 1.83 | -1.46 | 1.33 | |||
| adrenal gland | 1.23 | -1.50 | 1.33 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood