rs75775847 chr12:68578952 A>G
- Sequence
atgcccctaaagcaattctgaatg[A/G]cgtaattgagttaagagtgatgtc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ATF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF3_HUMAN | 2.67 | n/a | 2.00 | -7.61 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_EBV-transformed_lymphocytes, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Whole_Blood