rs75782549 chr15:92899846 A>T
- Sequence
gcatcataaagaaggaaaaacttg[A/T]atttatattatgaaattaaggttt
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.10 | 0.85 | 1.85 |
Items per page:
1 – 1 of 1