rs757900 chr7:74417562 T>C
- Sequence
gtcttgcctgtgatgcctcccatt[T/C]accagcaggtgtcaccctcggccc
- ASB in cell types
- erythroid cells K562 (myelogenous leukemia) foreskin keratinocyte HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 3.37 | n/a | 2.00 | |||
| K562 (myelogenous leukemia) | 0.45 | 0.53 | 1.42 | |||
| foreskin keratinocyte | n/a | 0.38 | 2.50 | |||
| HeLa S3 (cervical adenocarcinoma) | -0.36 | 1.31 | 2.00 | |||
| HeLa Kyoto (cervical adenocarcinoma) | 0.85 | -0.40 | 2.00 |
Items per page:
1 – 5 of 8