rs758142 chr17:57663425 G>A
- Sequence
tgcgtgcctgtggcagaggcttgt[G/A]tagccgggaaaggcaccccagccc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- RFX1_HUMAN BMI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | 2.13 | -1.75 | 1.75 | n/a | No Hit | |||
| BMI1_HUMAN | 2.20 | -2.74 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, mitral annular calcium