rs758152 chr17:68315191 C>T
- Sequence
ttattctttcagggctgggcagaa[C/T]tggggaatcagcaaagagaatcca
- ASB in cell types
- monocyte-derived macrophages periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived macrophages | -3.87 | 2.27 | 2.50 | |||
| periferal blood macrophages | 1.59 | 0.12 | 2.00 |
Items per page:
1 – 2 of 2