rs7585767 chr2:70111212 A>G
- Sequence
acccaggctggaatgcattgacag[A/G]atcctagctcactgcagcctctaa
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.19 | 0.88 | 1.99 | |||
| HepG2 (hepatoblastoma) | 0.81 | -0.21 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, diastolic blood pressure (dbp), height, ldl cholesterol, rheumatoid arthritis, systolic blood pressure (sbp), total cholesterol, triglycerides
GTEx eQTL Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood