rs75864726 chr4:165131470 A>G
- Sequence
tgtttctctttttttgctttagct[A/G]tttgtcagagggagacagcagact
- ASB in cell types
- medulloblastoma MCF7 (Invasive ductal breast carcinoma) AG04449 (fibroblasts) mammary epithelial cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| medulloblastoma | 2.20 | -2.01 | 1.33 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.05 | -0.21 | 1.94 | |||
| AG04449 (fibroblasts) | 1.45 | -1.48 | 1.00 | |||
| mammary epithelial cells | 1.61 | -1.49 | 1.33 |
Items per page:
1 – 4 of 4