rs7589090 chr2:215736977 A>C
- Sequence
cagatcacccacgtagaaaatcaa[A/C]cttgggggcaagcctcatggttaa
- ASB in cell types
- A549 (lung carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.62 | 0.96 | 2.29 | |||
| foreskin keratinocyte | n/a | 1.74 | 1.50 |
Items per page:
1 – 2 of 2