rs7589580 chr2:215404531 T>G
- Sequence
acccacattgtactgcctgggctg[T/G]cctcttcgggtaaggcccacggtc
- ASB in cell types
- HepG2 (hepatoblastoma) dermal fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.07 | -0.48 | 2.00 | |||
| dermal fibroblasts | -1.26 | 1.86 | 2.00 |
Items per page:
1 – 2 of 2