rs7593743 chr2:24971717 G>A
- Sequence
gacccgggcctgctcgggggcgga[G/A]aggaggccgggccccaggctgttg
- ASB in cell types
- CD14+ monocytes cranial neural crest cells
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.38 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), fasting blood glucose, mitral annular calcium, serum creatinine, waist hip ratio
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Spleen