rs7596223 chr2:62570365 T>C
- Sequence
taacctcccttcccctccccaccc[T/C]ccatttaagaatgcggtttttgtt
- ASB in cell types
- HepG2 (hepatoblastoma) A549 (lung carcinoma) liver
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.01 | 0.89 | 1.99 | |||
| A549 (lung carcinoma) | 0.49 | 0.37 | 1.34 | |||
| liver | 0.87 | 0.35 | 1.33 |
Items per page:
1 – 3 of 3