rs760156 chr21:38987295 T>C
- Sequence
gttctagtgtccccaagcctgtga[T/C]gggtgtgcaagatagcgccgtcct
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 1.38 | -1.67 | 1.50 | -1.44 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
