rs760347 chr21:14568068 C>T
- Sequence
gaaatgatgtccattctagaaatt[C/T]tgattgagtaagtctggattaagc
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 1.45 | n/a | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alcohol dependence symptoms, infant head circumference, microalbuminuria, urinary albumin-to-creatinine ratio