rs760430 chr21:44761511 G>A
- Sequence
cagccgaggctggaaccatcagac[G/A]aggctctaaggcagttccggcagc
- ASB in cell types
- K562 (myelogenous leukemia) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.28 | 0.56 | 1.32 | |||
| T47D (invasive ductal carcinoma) | 1.25 | -0.34 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, cystatin c in serum, height, parkinsons disease, paternal transmission distortion, total cholesterol change with statins, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Nerve_Tibial, Spleen, Testis, Whole_Blood