rs760517 chr22:36862944 C>T
- Sequence
ctcccccagggcaggctccaaaac[C/T]tcccccaggccaggctccaaagtc
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.23 | 0.65 | 1.28 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI eosinophil counts, eosinophil percentage of granulocytes, eosinophil percentage of white cells, neutrophil percentage of granulocytes
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood