rs760762 chr20:41147406 C>T
- Sequence
tctggcctgagaactggtctacac[C/T]ggaagcatgaagctccatacaatc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.90 | 0.21 | 1.49 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI age-related disease endophenotypes, age-related diseases, mortality and associated endophenotypes
GRASP biploar disorder (bipolar schizoaffective disorder), chronic kidney disease, ldl cholesterol, total cholesterol
GTEx eQTL Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Pancreas, Pituitary, Thyroid