rs760855 chr6:144335517 C>T
- Sequence
ctgacctgcctccgtagttgaacc[C/T]gattcctgaggcaatgatatggca
- ASB in cell types
- germinal center B-cells
- ASB for transcription factors
- BCL6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BCL6_HUMAN | 1.77 | -1.88 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1