rs7608941 chr2:223989351 C>A
- Sequence
tgacaatgttttggcaaagtgacc[C/A]agaatagtgaggcgtggctgaggc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte VCaP (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.32 | 1.35 | 1.64 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP childhood acute lymphoblastic leukemia, crohns disease, combined control dataset, gender differentiated, height, irritible bowel syndrome