rs7609043 chr2:85792251 G>T
- Sequence
tgcccatgaaacaagattctttct[G/T]atcttaatgtttgctgcaaaggaa
- ASB in cell types
- HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | -1.10 | 1.59 | 2.00 |
Items per page:
1 – 1 of 1