rs761098 chr6:2448952 A>C
- Sequence
aacagcaccctccactggtcgcta[A/C]aggaaagtgtgcttttgtgatgtg
- ASB in cell types
- HepG2 (hepatoblastoma) hepatocytes HUVEC (umbilical vein endothelial cells) A549 (lung carcinoma)
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | -0.50 | 1.03 | 1.60 | n/a | No Hit |
Items per page:
1 – 1 of 1