rs761273 chr20:48698950 A>G
- Sequence
gaggcaaagtcacagagctacaaa[A/G]gaggttaaacggggatccaatggc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -1.43 | 1.23 | 5.98 | |||
| HEK293 (embryonic kidney) | -0.04 | 0.46 | 2.02 |
Items per page:
1 – 2 of 2