rs7613595 chr3:16867007 C>A
- Sequence
tctgctgatatgccggctctagaa[C/A]cttataggtgcctctgccctctcc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.58 | -0.17 | 1.71 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, college completion, microalbuminuria, parkinsons disease, systolic blood pressure (sbp), triglycerides change with statins, urinary albumin-to-creatinine ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Skin_Sun_Exposed_Lower_leg, Whole_Blood