rs761740 chr22:43385844 C>A
- Sequence
gcagggatggaagaagcctcagtg[C/A]gaagcccggcgatggccggggcgc
- ASB in cell types
- erythroid cells HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 3.18 | n/a | 2.00 | |||
| HeLa Kyoto (cervical adenocarcinoma) | -0.16 | 0.71 | 2.00 |
Items per page:
1 – 2 of 2