rs7620 chr16:12574088 C>T
- Sequence
aagtctgtggaaacgccctgaaac[C/T]tgtagtattatcttaactaccctc
- ASB in cell types
- GM12878 (female B-cells) MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.67 | 0.07 | 1.61 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.84 | 0.33 | 1.69 | |||
| foreskin keratinocyte | 2.09 | n/a | 3.00 | |||
| epithelial cell of prostate | -1.36 | 1.15 | 1.33 |
Items per page:
1 – 4 of 4