rs76252336 chr13:45047510 C>A
- Sequence
ggaaatgttagcgattccacaagg[C/A]ggcactagagttccacctgtctcc
- ASB in cell types
- HEK293 (embryonic kidney) CD14+ monocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.77 | 0.00 | 2.20 | |||
| CD14+ monocytes | 1.63 | n/a | 2.50 |
Items per page:
1 – 2 of 2