rs76282635 chr2:237858483 T>C
- Sequence
ccagtggatgacctcgctgtcagc[T/C]gtctccccttctctgagcttactg
- ASB in cell types
- pancreas normal lung fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 2.18 | -1.64 | 2.00 | |||
| normal lung fibroblasts | 1.57 | n/a | 1.33 |
Items per page:
1 – 2 of 2