rs763373 chr11:12818795 C>G
- Sequence
caatttataattgcaccggaaata[C/G]ttgtaacctttatcatgcttagtg
- ASB in cell types
- SUM159PT (pleiomorphic breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SUM159PT (pleiomorphic breast carcinoma) | -0.34 | 1.28 | 2.00 |
Items per page:
1 – 1 of 1