rs76369074 chr16:84966129 A>C
- Sequence
gcgcacatacaatcacgcacacac[A/C]atcacgcacacacacaatcacgcg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.82 | 0.00 | 1.79 | |||
| HEK293 (embryonic kidney) | 0.23 | 0.44 | 1.71 |
Items per page:
1 – 2 of 2