rs763725 chr6:84883313 C>T
- Sequence
aaatttactttgaaaactgaggca[C/T]accaaaattttattaggtgaaact
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZNF34_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF34_HUMAN | 1.84 | -2.25 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, college completion, cystatin c in serum, obesity with early age of onset (age >2), years of education