rs7640801 chr3:152444061 G>A
- Sequence
aagaaaacctttgcttcctaagtc[G/A]tagtagggttacagtttttctttc
- ASB in cell types
- upper lobe of left lung OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| upper lobe of left lung | 1.49 | -1.30 | 1.00 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | -0.85 | 1.20 | 1.17 |
Items per page:
1 – 2 of 2