rs764155 chr21:37258389 G>T
- Sequence
cagtgttaaaacctggcgccaaaa[G/T]gaacatgcgatgtgacgtgttacc
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- NRF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 2.08 | -2.81 | 2.00 | 0.69 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Thyroid