rs7643379 chr3:192901594 A>G
- Sequence
caatgaatatgcttcaatgcttta[A/G]aacaagtcaaggtacaaacatatg
- ASB in cell types
- Bladder carcinoma (JMSU-1)
- ASB for transcription factors
- RXRA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RXRA_HUMAN | 1.22 | -0.57 | 1.39 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alcohol dependence, alcohol dependence (early age of onset), alcohol dependence without depressive symptoms, comorbid depressive syndrome and alcohol dependence, hypertension (early onset hypertension), waist hip ratio