rs76478953 chr20:37179882 A>G
- Sequence
aaacttgcagtcggccacgtattc[A/G]ttgtgtaacccaaagcaggttact
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.24 | 0.84 | 2.00 | |||
| HEK293 (embryonic kidney) | -0.34 | 0.73 | 1.99 | |||
| HepG2 (hepatoblastoma) | 0.31 | 0.52 | 1.27 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg