rs765265 chr1:231140261 G>A
- Sequence
tctctgtcacatgtgggactgtag[G/A]atacctgcccgcccagcctctgta
- ASB in cell types
- A549 (lung carcinoma) ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.89 | -0.23 | 2.02 | |||
| ZR-75-1 (invasive ductal carcinoma) | -1.25 | 1.48 | 4.83 |
Items per page:
1 – 2 of 2