rs7653172 chr3:13394050 T>C
- Sequence
cttgacaagccacagtagaaaatg[T/C]cttgtatcccagggcagggggcac
- ASB in cell types
- HepG2 (hepatoblastoma) liver
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.38 | 0.73 | 1.26 | |||
| liver | 1.09 | -0.50 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg