rs765506 chr7:112573705 G>A
- Sequence
tgtctgaataattcacaaatgcaa[G/A]ttcagctcctgaataagcagtaca
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
- ASB for transcription factors
- MTG16_HUMAN ZN189_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MTG16_HUMAN | -1.40 | 1.18 | 1.33 | n/a | n/a | |||
| ZN189_HUMAN | 2.21 | -3.26 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, chronic kidney disease, ldl cholesterol, ldl cholesterol change with statins, prop taste detection threshold, total cholesterol, total cholesterol change with statins
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid