rs765751 chr1:219495884 T>C
- Sequence
aaaatgggagtacatcatgctgcg[T/C]tccaaatcgtttatcatcttaaaa
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- WT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| WT1_HUMAN | 1.18 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI waist-to-hip ratio adjusted for bmi (adjusted for smoking behaviour), waist-to-hip ratio adjusted for bmi (joint analysis main effects and smoking interaction), waist-to-hip ratio adjusted for bmi in non-smokers
GRASP adiponectin levels, fasting insulin, hdl cholesterol, height, homa-b, homa-ir, ldl cholesterol, tardive dyskinesia, triglycerides, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Colon_Transverse, Kidney_Cortex, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg