rs7667067 chr4:184854766 A>G
- Sequence
ccactaaatatgaagaggcagtgg[A/G]ctgggaataatgagagaagaccca
- ASB in cell types
- K562 (myelogenous leukemia) macrophages fetal bone marrow-derived mononuclear cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.25 | 1.13 | 1.99 | |||
| macrophages | 2.10 | -1.93 | 2.00 | |||
| fetal bone marrow-derived mononuclear cells | -1.78 | 1.79 | 1.50 |
Items per page:
1 – 3 of 3