rs767019 chr16:11163079 G>T
- Sequence
gtttgcacctacttcgcagcccaa[G/T]tgtgtttgattcatacaccaaaag
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.61 | -0.00 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, comorbid depressive syndrome and alcohol dependence, fasting insulin, hdl cholesterol, homa-b, homa-ir, ldl cholesterol, major depressive disorder, total cholesterol, type 1 diabetes, combined control dataset, waist hip ratio
GTEx eQTL Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Muscularis, Lung, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid