rs7672311 chr4:15730067 G>A
- Sequence
aaattttgagtgaatcgagtctgg[G/A]acattaactgcatcacaggtgcaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte epidermal keratinocytes A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.04 | -0.16 | 1.95 | |||
| foreskin keratinocyte | 0.47 | n/a | 2.50 | |||
| epidermal keratinocytes | 1.66 | -1.26 | 2.00 | |||
| A549 (lung carcinoma) | 0.63 | 0.71 | 1.16 |
Items per page:
1 – 4 of 4