rs767834 chr7:28586758 C>G
- Sequence
agccttctaaaagtggtttgtaag[C/G]aaactccagtaataatcacattct
- ASB in cell types
- BEAS-2B (bronchial epithelium)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BEAS-2B (bronchial epithelium) | 0.14 | 1.58 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, appendicular lean mass-femoral neck buckling ratio bivariate association, appendicular lean mass-femoral neck cortical thickness bivariate association, appendicular lean mass-femoral neck cross-sectional area bivariate association, appendicular lean mass-femoral neck periosteal diameter bivariate association, appendicular lean mass-femoral neck section modulus bivariate association, ldl cholesterol change with statins, rheumatoid arthritis